ID: 1066437345_1066437364

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1066437345 1066437364
Species Human (GRCh38) Human (GRCh38)
Location 10:35406821-35406843 10:35406867-35406889
Sequence CCTCACCTCCCGGATGGGGCGGC CCCCCACCTCCGTCCCCGTCGGG
Strand - +
Off-target summary {0: 342, 1: 2410, 2: 2847, 3: 3819, 4: 9600} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!