ID: 1067125550_1067125555

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1067125550 1067125555
Species Human (GRCh38) Human (GRCh38)
Location 10:43512507-43512529 10:43512546-43512568
Sequence CCCAGTAATAGGCCAAGAACTGT AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 4, 1: 28, 2: 203, 3: 214, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!