ID: 1067404667_1067404678

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1067404667 1067404678
Species Human (GRCh38) Human (GRCh38)
Location 10:46010754-46010776 10:46010795-46010817
Sequence CCAATCCTCTGTAACCATGCTGG TGGCCTCCAAGTGGTCATTCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 14, 4: 159} {0: 2, 1: 0, 2: 4, 3: 22, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!