ID: 1067533654_1067533659

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1067533654 1067533659
Species Human (GRCh38) Human (GRCh38)
Location 10:47092612-47092634 10:47092633-47092655
Sequence CCTCCCTCAGTGGCCCTCTGATG TGCCCTTAAGTGTACCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!