ID: 1067590232_1067590241

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1067590232 1067590241
Species Human (GRCh38) Human (GRCh38)
Location 10:47502646-47502668 10:47502697-47502719
Sequence CCAAGTTCAAACTGGCCCACTTA GGGCGTTCCCACGCATGTTTTGG
Strand - +
Off-target summary {0: 10, 1: 1, 2: 2, 3: 10, 4: 94} {0: 8, 1: 2, 2: 0, 3: 2, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!