ID: 1068171819_1068171831

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1068171819 1068171831
Species Human (GRCh38) Human (GRCh38)
Location 10:53404180-53404202 10:53404219-53404241
Sequence CCCCAGCACCACCCTGGAGTGTG GCTAGACCCAGAGGAGCAGCAGG
Strand - +
Off-target summary No data {0: 8, 1: 13, 2: 12, 3: 40, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!