ID: 1068360794_1068360798

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1068360794 1068360798
Species Human (GRCh38) Human (GRCh38)
Location 10:55973535-55973557 10:55973549-55973571
Sequence CCATGTCCCATCTGTGTGGGACC TGTGGGACCCCACTGGAAATCGG
Strand - +
Off-target summary {0: 82, 1: 298, 2: 258, 3: 133, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!