ID: 1068984412_1068984417

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1068984412 1068984417
Species Human (GRCh38) Human (GRCh38)
Location 10:63094067-63094089 10:63094085-63094107
Sequence CCCCCAATTATTGTGACCAACAA AACAAAAATGTCCCCAAACATGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 9, 3: 90, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!