ID: 1069049635_1069049648

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1069049635 1069049648
Species Human (GRCh38) Human (GRCh38)
Location 10:63778940-63778962 10:63778984-63779006
Sequence CCACCCCCACCCCATTATGGAAA TCTCTGGTGCCAAAAAGGTTGGG
Strand - +
Off-target summary No data {0: 78, 1: 1103, 2: 1667, 3: 1354, 4: 955}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!