ID: 1069049636_1069049644

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1069049636 1069049644
Species Human (GRCh38) Human (GRCh38)
Location 10:63778943-63778965 10:63778968-63778990
Sequence CCCCCACCCCATTATGGAAAAAC TCTTCCACAAAACTGGTCTCTGG
Strand - +
Off-target summary No data {0: 16, 1: 249, 2: 558, 3: 1169, 4: 1339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!