ID: 1069519896_1069519904

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1069519896 1069519904
Species Human (GRCh38) Human (GRCh38)
Location 10:69110590-69110612 10:69110641-69110663
Sequence CCCAGTGAGCAGGAGCATTGGGT AGAGAGAAGTAGCCTGAGGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!