ID: 1069547805_1069547813

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1069547805 1069547813
Species Human (GRCh38) Human (GRCh38)
Location 10:69341253-69341275 10:69341283-69341305
Sequence CCCAGCTCAGGCAATCCTCCCGC TCCCGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 2, 1: 70, 2: 908, 3: 6456, 4: 25911} {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!