ID: 1069594954_1069594962

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1069594954 1069594962
Species Human (GRCh38) Human (GRCh38)
Location 10:69664437-69664459 10:69664477-69664499
Sequence CCCCATGGGGTACACGGGAGAGG CTCTGTCTCTCAGATCCCACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!