ID: 1069698424_1069698447

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1069698424 1069698447
Species Human (GRCh38) Human (GRCh38)
Location 10:70404618-70404640 10:70404671-70404693
Sequence CCCGGCCGCTTCGCCCCCGCCCC CTTGGGCCCGCCCGAGCGTTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 79, 4: 667} {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!