ID: 1069698438_1069698447

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1069698438 1069698447
Species Human (GRCh38) Human (GRCh38)
Location 10:70404646-70404668 10:70404671-70404693
Sequence CCACCGAAGCCCCGGGGACGCTG CTTGGGCCCGCCCGAGCGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 129} {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!