ID: 1069698439_1069698447

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1069698439 1069698447
Species Human (GRCh38) Human (GRCh38)
Location 10:70404649-70404671 10:70404671-70404693
Sequence CCGAAGCCCCGGGGACGCTGCCC CTTGGGCCCGCCCGAGCGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199} {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!