ID: 1069932367_1069932373

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1069932367 1069932373
Species Human (GRCh38) Human (GRCh38)
Location 10:71891404-71891426 10:71891427-71891449
Sequence CCCAGCTCTACTAGGGAGAGAGA CCCACAAATAGGGATAGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!