ID: 1069976283_1069976292

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1069976283 1069976292
Species Human (GRCh38) Human (GRCh38)
Location 10:72215984-72216006 10:72216023-72216045
Sequence CCACGCCCACCACGGCACGGGCG GCCGCTGGCTCCGTCTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!