ID: 1069976284_1069976294

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1069976284 1069976294
Species Human (GRCh38) Human (GRCh38)
Location 10:72215989-72216011 10:72216024-72216046
Sequence CCCACCACGGCACGGGCGCGCGC CCGCTGGCTCCGTCTGTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55} {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!