ID: 1071283280_1071283288

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1071283280 1071283288
Species Human (GRCh38) Human (GRCh38)
Location 10:84122605-84122627 10:84122641-84122663
Sequence CCATCTATTGTCCTGTCCTGAAG GGTCTGGTCAGACCTTTGTATGG
Strand - +
Off-target summary {0: 32, 1: 55, 2: 84, 3: 64, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!