ID: 1071822537_1071822548

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1071822537 1071822548
Species Human (GRCh38) Human (GRCh38)
Location 10:89293018-89293040 10:89293062-89293084
Sequence CCCACCCAAATCTCATCTCAAAT GTGTCAAGGGCAGGACCTGATGG
Strand - +
Off-target summary {0: 673, 1: 1973, 2: 10309, 3: 12710, 4: 10112} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!