ID: 1072328111_1072328118

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1072328111 1072328118
Species Human (GRCh38) Human (GRCh38)
Location 10:94318578-94318600 10:94318621-94318643
Sequence CCATCCTGTGCTACCCAAGCTGA ATCACCCACACTCAGCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!