ID: 1072360470_1072360473

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1072360470 1072360473
Species Human (GRCh38) Human (GRCh38)
Location 10:94654169-94654191 10:94654189-94654211
Sequence CCTTTTGAGAGACAGCTCTTGGA GGACTGTTACTCGGCTTTGGTGG
Strand - +
Off-target summary {0: 4, 1: 196, 2: 185, 3: 171, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!