ID: 1072424525_1072424536

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1072424525 1072424536
Species Human (GRCh38) Human (GRCh38)
Location 10:95318759-95318781 10:95318799-95318821
Sequence CCAACCTTTTAGGCACCAGGGAC ATTTTTCCACAGATGGGGTGGGG
Strand - +
Off-target summary No data {0: 8, 1: 32, 2: 102, 3: 250, 4: 712}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!