ID: 1072591472_1072591488

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1072591472 1072591488
Species Human (GRCh38) Human (GRCh38)
Location 10:96832213-96832235 10:96832254-96832276
Sequence CCCGGGCCGCGGGTGCGTGCGCG GGGCGTGCGCGGGGCCGCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 105, 4: 703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!