ID: 1072591473_1072591491

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1072591473 1072591491
Species Human (GRCh38) Human (GRCh38)
Location 10:96832214-96832236 10:96832262-96832284
Sequence CCGGGCCGCGGGTGCGTGCGCGG GCGGGGCCGCGGCGGAGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 88, 4: 715}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!