ID: 1072602561_1072602565

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1072602561 1072602565
Species Human (GRCh38) Human (GRCh38)
Location 10:96942400-96942422 10:96942415-96942437
Sequence CCAGCTTTGGCTCGGCATCAGAG CATCAGAGGGAGACCGTGGAAGG
Strand - +
Off-target summary {0: 142, 1: 549, 2: 481, 3: 358, 4: 290} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!