ID: 1072725072_1072725077

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1072725072 1072725077
Species Human (GRCh38) Human (GRCh38)
Location 10:97807605-97807627 10:97807635-97807657
Sequence CCAGCAGTGGACAACTCTAGGGG CACAGAGGCCTCAAGACGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!