ID: 1072725072_1072725081

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1072725072 1072725081
Species Human (GRCh38) Human (GRCh38)
Location 10:97807605-97807627 10:97807652-97807674
Sequence CCAGCAGTGGACAACTCTAGGGG GAGTGGCACCCCATATGGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!