ID: 1073112687_1073112691

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1073112687 1073112691
Species Human (GRCh38) Human (GRCh38)
Location 10:101072021-101072043 10:101072046-101072068
Sequence CCATCCATCTCTTTTATCTGGGC ATGAAGGGCTAGAGCTCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 339} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!