ID: 1073535105_1073535112

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1073535105 1073535112
Species Human (GRCh38) Human (GRCh38)
Location 10:104269224-104269246 10:104269251-104269273
Sequence CCCGAGTTCCCGGAGGTCTCTCG ACCTCTCTCACCGCCACCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60} {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!