ID: 1073876883_1073876887

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1073876883 1073876887
Species Human (GRCh38) Human (GRCh38)
Location 10:107934586-107934608 10:107934626-107934648
Sequence CCTGCTACTTTTCTTCCTTTATC ATTGGATTCATTTGATGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 859} {0: 1, 1: 0, 2: 0, 3: 32, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!