ID: 1073918474_1073918479

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1073918474 1073918479
Species Human (GRCh38) Human (GRCh38)
Location 10:108432279-108432301 10:108432318-108432340
Sequence CCAGTAACAGGCCAAGAGCTGTC GTTATCTGCAGAAGATGGCAGGG
Strand - +
Off-target summary No data {0: 180, 1: 172, 2: 120, 3: 86, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!