|
Left Crispr |
Right Crispr |
| Crispr ID |
1074073548 |
1074073557 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:110098783-110098805
|
10:110098824-110098846
|
| Sequence |
CCACGCCCAACTAATTTTTTGTA |
TTTCACTATGTTGGCCAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 187, 1: 8755, 2: 34498, 3: 46231, 4: 61532} |
{0: 8986, 1: 103834, 2: 178729, 3: 238015, 4: 254109} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|