ID: 1074248047_1074248056

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1074248047 1074248056
Species Human (GRCh38) Human (GRCh38)
Location 10:111714169-111714191 10:111714204-111714226
Sequence CCCAAGCCCCCAAGAGTGCAGAG CCACATTTGCAGCTGCACCCAGG
Strand - +
Off-target summary {0: 2, 1: 11, 2: 50, 3: 146, 4: 923} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!