|
Left Crispr |
Right Crispr |
| Crispr ID |
1074248047 |
1074248057 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:111714169-111714191
|
10:111714207-111714229
|
| Sequence |
CCCAAGCCCCCAAGAGTGCAGAG |
CATTTGCAGCTGCACCCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 11, 2: 50, 3: 146, 4: 923} |
{0: 1, 1: 2, 2: 17, 3: 55, 4: 302} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|