ID: 1074248049_1074248057

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1074248049 1074248057
Species Human (GRCh38) Human (GRCh38)
Location 10:111714175-111714197 10:111714207-111714229
Sequence CCCCCAAGAGTGCAGAGAGATGA CATTTGCAGCTGCACCCAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 17, 3: 55, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!