ID: 1074406405_1074406414

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1074406405 1074406414
Species Human (GRCh38) Human (GRCh38)
Location 10:113183652-113183674 10:113183699-113183721
Sequence CCATGCAGGCTTCGGGCCGGCCT CTGGCCATGAGAGATGCCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!