ID: 1074619656_1074619663

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1074619656 1074619663
Species Human (GRCh38) Human (GRCh38)
Location 10:115106016-115106038 10:115106061-115106083
Sequence CCTTGCACCATGTGCCTGGAAAA CCATGAAAGCAGCCAGGATGAGG
Strand - +
Off-target summary {0: 4, 1: 7, 2: 24, 3: 45, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!