ID: 1074670039_1074670051

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1074670039 1074670051
Species Human (GRCh38) Human (GRCh38)
Location 10:115780105-115780127 10:115780154-115780176
Sequence CCCCCAGTAGCAGCCACATGCAC AGGGAGAGCACAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 181} {0: 23, 1: 59, 2: 130, 3: 192, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!