ID: 1074754680_1074754688

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1074754680 1074754688
Species Human (GRCh38) Human (GRCh38)
Location 10:116615620-116615642 10:116615659-116615681
Sequence CCACAGGTGCTGACCTTCGCTTC GCTGGCACCTTGGGCCTTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!