ID: 1074870202_1074870214

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1074870202 1074870214
Species Human (GRCh38) Human (GRCh38)
Location 10:117570146-117570168 10:117570195-117570217
Sequence CCCTCCCCACCTGGCTTGGAGTC CTGCAGAGAGCTCAGTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!