ID: 1075579878_1075579885

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1075579878 1075579885
Species Human (GRCh38) Human (GRCh38)
Location 10:123609397-123609419 10:123609422-123609444
Sequence CCCCTAGCAGCTGCTACTGCTTC TTCGACTGGGCACTACTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!