ID: 1075653644_1075653650

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1075653644 1075653650
Species Human (GRCh38) Human (GRCh38)
Location 10:124146971-124146993 10:124147009-124147031
Sequence CCTGGCTAAGGGCCTGGTCTATG TGGCTGACATTGCTAGTGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!