ID: 1075664777_1075664786

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1075664777 1075664786
Species Human (GRCh38) Human (GRCh38)
Location 10:124222509-124222531 10:124222537-124222559
Sequence CCTCAGGCTGCTCACAGTCCAGT GGCCTGAGCGTAGGGCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 90, 4: 567} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!