ID: 1075738236_1075738248

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1075738236 1075738248
Species Human (GRCh38) Human (GRCh38)
Location 10:124677389-124677411 10:124677429-124677451
Sequence CCAAAAACACCACGTAAGGAGGA CACGGGGCCGGGCTTGCGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!