ID: 1076480719_1076480733

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1076480719 1076480733
Species Human (GRCh38) Human (GRCh38)
Location 10:130783671-130783693 10:130783705-130783727
Sequence CCCCCTTTAGCATGAAAAGTCCC GGGGCCGAGGGAGGGTCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 59, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!