ID: 1076513142_1076513149

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1076513142 1076513149
Species Human (GRCh38) Human (GRCh38)
Location 10:131026334-131026356 10:131026360-131026382
Sequence CCTGGGACTTGCCATGGCCAAGA ACGAAGTCAGGCAGGCTTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!