ID: 1076891761_1076891767

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1076891761 1076891767
Species Human (GRCh38) Human (GRCh38)
Location 10:133288185-133288207 10:133288212-133288234
Sequence CCAGGAGCGCTTCCAGGCGAGGG TGATGTCCTCCACCGGCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 148} {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!