ID: 1077136215_1077136232

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1077136215 1077136232
Species Human (GRCh38) Human (GRCh38)
Location 11:1000476-1000498 11:1000499-1000521
Sequence CCCCCCTGCCCCCGCGGGCCCCC CACCCTCCTCCGGCGGCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 135, 4: 1137} {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!